00-protes

Transcription

1 ﾁ (20)3, DOI K, IIDA M, KOHROGI N, MIBU R, ONITSUKA H, YAO T ET AL. Large intra-abdominal desmoid tumors in a patient with familial adenomatous coli: their rapid growth detected by computerized tomography. Am J Gastroenterol 1993, 88:595ｨC REITAMO JJ, HAYRY P, NYKYRI E, SAXEN E. The desmoid tumor: Incidence, sex-, age- and anatomical distribution in the Finnish population. Am J Clin Pathol 1982, 77:665ｨC CLARK S, NEALE F, LANDGREBE J, PHILLIPS R. Desmoid tumours complicating familial adenomatous polyposis. Br J Surg 1999, 86:1185ｨC NAYLOR EW, GARDNER EJ, RICHARD RC. Desmoid tumors and mesenteric fibromatosis in Gardner ｯs syndrome. Arch Surg 1979, 114:1181ｨC MERTENS F, WILLEN H, RYDHOLM A, BROSJO O, CARLEN B, MITEL- MAN F ET AL. Trisomy 20 is a primary chromosome aberration in desmoid tumors. Int J Cancer 1995, 63:527ｨC LANARI A. Effect of progesterone in desmoid tumors (aggressive fibromatosis). N Engl J Med 1983, 309: LYNCH H, FITZGIBBONS R. Surgery, desmoid tumors and familial adenomatous polyposis: a case report and literature review. Am J Gastroenterol 1996, 91:2598ｨC BALLO M, ZAGARS G, POLLACK A, PISTERS P, POLOCK R. Desmoid tumor: prognostic factors and outcome after surgery, radiation therapy, or combined surgery and radiation therapy. J Clin Oncol 1999, 17:158ｨC SMITH AJ, LEWIS JJ, MERCHANT NB, LEUNG D, WOODRUFF J, BREN- NAN M. Surgical management of intra-abdominal desmoid tumors. Br J Surg 2000, 87:608ｨC NUYTTENS J, RUST P, THOMAS C, TURRISI A. Surgery versus radiation therapy for patients with aggressive fibromatosis or desmoid tumors. Cancer 2000, 88:1517ｨC PATEL S, EVANS H, BENJAMIN R. Combination chemotherapy in adult desmoid tumors. Cancer 1993, 72:3244ｨC SEITER K, KEMENY N. Successful treatment of a desmoid tumor with doxorubicin. Cancer 1993, 71:2242ｨC BAUERRNHOFER T, STOGER H, SCHMID M, SMOLA M, GURTI-LACK- NER B, HOFLER G ET AL. Sequential treatment of recurrent mesenteric desmoid tumor. Cancer 1996, 77:1061ｨC GRANT D. Current results of intestinal transplantation. The International 07ntestinal 08ransplant Registry. Lancet 1996, 347:1801ｨC 1803 Corresponding author: G.V. Papatheodoridis, 2nd Academic Department of Medicine, ｰHippokration ｱ General Hospital, 114 Vas. Sophias Ave., GR Athens, Greece 02ｨｦｨ ｨｺｨ ｨｪｨｮ ｨｬｨｴ0604ｨｰ ｨ 08ｨｹ ｨｺ010000ｨ 0907ｨｬ0200ｨ 0507ｨｲｨｹ ｨｺｨ ｨｦ ｨｰ 0004ｨｰ ｨｮ02 05IV-1(+) ｨ ｨｮｨｨ02ｨｪ07 ﾁ. K070000ｨ , ｨｬ080104ｨｰ, ｨ ｨｰ, 2 ﾁ ｨｰ, ｨｪ05ｨｺ04ｨｰ, ｨｦ05ｨ 0507ｨｨ04ｨｰ, ｨ , ｨ ｨｮｨｦ070505ｨ ｨｰ ｨｬ07ｨｬｨ ｨｦｨ ｨｺ07ｨｰ 00ｨｦ ｨ ｨｰ, ｨｪ0400ｨｦｨｺｨｹ 0806ｨｪ ｨ ｨｪ0006ｨｪ04ｨｰ 04ｨ 08ｨ 00ｨｦ05ｨｪｨｪ04ｨｰ03, 2 09 ｯ 04ｨ ｨｨ ｨｦｨｺ ｨｦｨｪｨｦｨｺ07, ｨ 03, 3 01ｨ ｨｮ000902ｨｪ ｨｦｨｺｨｹ 08ｨｬ07ｨｬｨ, ｨ 03 Elucidation of cytomegalovirus infection and recurrence in a HIV-1(+) patient ｨｦｨｰ : 09ｨｪｨｨ02ｨｺ00ｨｦｨｺｨｹ000400ｨ Ganciclovir HIV ｨ 0907ｨｬ0200ｨ 0507ｨｲｨｹｨｰ Abstract at the end of the article ｨｺｨ ｨｦ09ｨｦｨ ｨｺ ｨｬｨｴ0604 ｨ 08ｨｹ ｨｺ010000ｨ 0907ｨｬ0200ｨ 0507ｨｲｨｹ (CMV) ｨ ｨｮ0709ｨ 0907 ｨ ｨｦ0008ｨ ｨｨｨｪ04ｨｮｨｦｨｬｨｹ000400ｨ ｨｰ ｨｮ02 ｨ ｨｮｨｨ02ｨｪ0208ｨｰ ｨｬ02 ｨｮ05ｨｪ010907ｨｬ ｨｺ ｨｰ ｨ ｨｪ07ｨｮ07ｨ ｨｪ ｨｺ02ｨｦｨ ｨｰ (09IDS). 1, ｨｮ04ｨｬｨ ｨｪ00ｨｦｨｺｨｹ 0807ｨｮ07ｨｮ00ｨｹ ｨ ｨｪ07ｨｮ07ｨｺｨ 00ｨ ｨｮ00ｨ 05ｨｬ06ｨｪｨｴｨｪ 07 ｨｦｨｹｨｰ ｨ ｨｪｨ 03ｨｴ ｨｪ0200ｨ ｨｦ ｨ 08ｨｹ ｨ ｨｪｨｨ05ｨｪ0701ｨｮｨ ｨｺｨ 0005ｨｮ00ｨ ｨｮ04, ｨｬ02 ｨ ｨｮｨｬｨ 02ｨｪ020900ｨｹ ｨｬｨｴ ｨｦｨｺｨｹｨｰ ｨｮｨｴ0507ｨｪｨ ｨｰ, ｨｺｨ ｨｦ ｨｦ01ｨｦｨ ｨ 0007 ｨｺｨｹ0507ｨｪ, ｨ ｨｪｨ ｨ ｨｦ ｨｮ01 ﾂｨｪ05 ｨｴｨｰ 07 ｨｺ0509ｨｦ07ｨｰ ｨｮ00ｨｹ ﾂ07ｨｰ ｨ ｨｰ CMV ｨｬｨｴ0604ｨｰ ｨｮ000701ｨｰ HIV-1(+) ｨ ｨｮｨｨ02ｨｪ0208ｨｰ. 05 ｨｺ070507ｨｪ07ｨｮｨｺｨｹ0804ｨｮ ｨ 09ｨｬｨｹ030200ｨ ｨｦ ｨｴｨｰ 00ｨｦｨ ｨｦ0500ｨｪｨｴｨｮ04 CMV-ｨｺ ｨｦ01ｨ ｨｰ, ｨｮ02 ｨｮ01ｨｪ0101ｨ ｨｮｨｬｨｹ ｨｬ02 00ｨ ｨｦｨｮ ｨｦｨｺ ｨｬｨ 00ｨ ｨｺｨ ｨｦ 0004ｨｪ ｨｺｨ 0505ｨｦ ｨｦｨ CMV. 2,4ｨC6 05 ｨ ｨｺ09ｨｦ0907ｨｰ ｨｹｨｬｨｴｨｰ ｨｮ01ｨｮ ﾂ0600ｨｦｨｮ04 ｨ ｨｪ05ｨｬ02ｨｮｨ ｨｮ0007 CMV ｨｺｨ ｨｦ ｨｮ ｨｪｨｪ0700ｨｹｨｪ ｨｺｨｹ ｨ 09ｨ ｨｬ06ｨｪ02ｨｦ ｨ ｨｮｨ 0207ｨｰ ｨ 08ｨ, 04 CMV ｨｬｨｴ0604 ｨｮ0007 ｨｺｨｹ0507ｨｪ 01ｨｦ ｨｪ07ｨｨ04ｨｺ02 01ｨｦ ｨｦｨｺｨｹ000209ｨ ｨｬ ｨｪ 0202ｨ 09ｨｬ ｨｬ02ｨｨｨｹ01ｨｴｨｪ ｨｬ0709ｨｦｨ ｨｺ07ｨｰ 09ｨｦ ｨ ｨｰ, 09ｨ ｨｮｨｦｨｮｨｬ06ｨｪｨｴｨｪ ｨｺ010908ｨｴｨｰ ｨｮ0004ｨｪ PCR. 6,8, ｨｪ 08ｨ ｨｮｨ ｨ ｨｮ08ｨ, ﾂ0904ｨｮｨｦｨｬ070807ｨｦ06ｨｪ00ｨ ｨｰ ｨｬ02ｨｨｨｹ010701ｨｰ ｨｬ0709ｨｦｨ ｨｺ07ｨｰ 09ｨｦ ｨ ｨｰ, ｨ 0802ｨｦｨｺ07ｨｪ ｨ ｨｦ 04 08ｨ ｨｮ08ｨ CMV ｨｮ00ｨ ｨｦｨｮ ｨｦｨｺ05 08ｨ 09ｨ ｨｮｨｺ020105ｨｮｨｬｨ 00ｨ ｨ 08ｨｹ 00ｨｦｨｰ ﾂｨ 09ｨ ｨｺ000409ｨｦｨｮ00ｨｦｨｺ06ｨｰ ｨｰ ｨｺｨｹ ｨｦ ｨｪ, 04 ｨ ｨｪ050501ｨｮ04 ｨ ﾂ08ｨ ｨｰ DNA ｨｮ01ｨｮ ﾂ ｨｦ 0004ｨｪ ｨｰ ｨｪｨｹｨｮ0701 ｨｬ ｨｪ 02ｨｬ0205ｨｪｨｦｨｮ04 ｨ ｨｪｨｨ02ｨｺ00ｨｦｨｺ06ｨｪ ｨｮ ﾂ06ｨｪ CMV ｨｮ0004ｨｪ ｨ ｨｪ00ｨｦ ｨｲｨｺ07 ｨｨ0209ｨ ｨ ｨｮｦｰ061 7ｨｪ ｨｪ07ｦﾒ061 7ｨｪ

2 13312 ARCHIVES OF HELLENIC MEDICINE 20(3), ｨｪ0109ｨ ｨｰ 0405ｨｦｨｺ08ｨ ｨｰ ｨｪ, 07ｨｬ ｨｹ02ｨｦ0507ｨｰ, 00ｨｪｨｴｨｮ00ｨｹｨｰ ｨ 08ｨｹ ｨ ｨｬ07ｨｪ0701 ｨｴｨｰ HIV ｨｨ0200ｨｦｨｺｨｹｨｰ, 01ｨｦｨ ｨｺ07ｨｬ08ｨｮ0004ｨｺ02 ｨｮ0007 ｨｪ07ｨｮ07ｨｺ07ｨｬ ｨｮ00ｨｦｨｰ 29/9/ ｨｹ ｨｺ09ｨ 00ｨｦｨｺｨｹ ｨｪ07ｨｮ07ｨｺ07ｨｬ ｨ ｨｪｨ ｨｪ00ｨ ｨｪ 00ｨ ｨｰ: ｨ 08ｨｹ 01ｨｦｨｬ07ｨｪ0701 ｨ ｨｬｨ 00ｨｦｨｪ ｨｺｨ 00ｨｦｨｺ ｨｦｨｺ07 ｨｺ08ｨｪ04ｨｮ04 ｨｺ0ｹ1ｨ ｨｦ ｨ ｨｺｨ 07ｨｬ ｨｬ ｨｴｨｰ 39ｨC40 紊 ｨｬ ｨｮ04ｨｰ, ｨ 08ｨｹ 0206ｨ 04ｨｬ ｨｴｨｮ ｨｦ ｨｮ01ｨｪ ｨｮ04ｨｰ. 08ｨ ｨｦ07ｨｬ ｨｰ 02ｨｦｨｮｨ 00ｨｴ0007ｨｰ ｨ ｨｪｨ ｨｪ00ｨ ｨｪ ｨ ｨｮ0ｹ1ｨｮ0209ｨ ｨｦｨｮｨｹ01ｨｦｨ 0007ｨｪｨｦｨｺ07-ｨｺ0507ｨｪｨｦｨｺ06ｨｪ ｨｮ08ｨ ｨｮｨｬ06ｨｪ. 03 ｨ ｨｮｨｨ02ｨｪ07ｨｰ ｨｬ09ｨ ｨｪ02 ｨ ｨｪ00ｨｦ ｨｲｨｺ07 ｨｨ0209ｨ ｨ ｨｬ02 zidovudin 250 mg ｨｺｨ ｨｦ lamivudin 150 mg ｨｪ 04ｨｬ0609ｨ 0004ｨｰ 02ｨｦｨｮｨ 00ｨｴ0007ｨｰ ｨ ｨｮｨｨ02ｨｪ07ｨｰ 0700ｨ ｨｪ ｨｮ0100 ﾂ0100ｨｦｨｺｨｹｨｰ, ｨｬ02 ｨｹ ｨ 0906ｨｴｨｰ 0805ｨｮ ﾂ07ｨｪ0007ｨｰ ｨｺｨ ｨｦ ｨｨ0209ｨｬ07ｨｺ09ｨ ｨｮ08ｨ 39,5 紊. 0202ｨｪ ﾂｨ ｨｪ ｨｮ0007ｨｦ ﾂ0208ｨ ｨｬ04ｨｪｨｦ0000ｨｦｨｮｨｬ ｨｮ00ｨｦｨ ｨｺ05 ｨｪ ｨｦｨｺ05 ｨｮ04ｨｬ02080ｹ1ｨ ｨｺｨ ｨｪ ｨｦｨｺ ｨ ｨｮ ｨｦ0807 ｨ ｨｪ00ｨｦｨｺ02ｨｦｨｬ02ｨｪｨｦｨｺ ｨ ｨｮ ｨ ｨｪ ﾂｨｴ0908ｨｰ 0701ｨｮｨｦ ｨ ｨｨ ｨｦｨｺ ｨｬｨ 00ｨ ｨｨ07ｨｮｨｺｨｹ0804ｨｮ ｨ ｨｪ ｨ 09ｨｪ0400ｨｦｨｺ ｨｦｨｪ02 07ｨｮ020107ｨｪｨｴ00ｨｦｨ 08ｨ 08ｨ 09ｨ ｨｺ06ｨｪ0004ｨｮ04, ｨｹ ｨｦｨ 08ｨｦ0ｹ1ｨｮ0006ｨｨ04ｨｺ02 ｨ ｨｮ ｨｺ06ｨｬｨ 0007ｨｰ ｨｺ0202ｨ 0507ｨｪｨｴ00ｨｦｨ (90 mg/dl), 7 ｨｺ050000ｨ 09ｨ /mm 3, ｨｮ05ｨｺ ﾂｨ mg/dl, ﾂ05ｨｴ09ｨｦ0705 ﾂｨ 124 meq/l, ｨｺｨｦｨｬｨ ｨｮ08ｨ INDIA INK ｨｺｨ ｨｦ ﾂ07ｨｰ 07gM/07gG ｨ ｨｪ00ｨｦｨｮｨｴｨｬ0500ｨｴｨｪ 00ｨｦｨ CMV ｨｮ ｨｺ0202ｨ 0507ｨｪｨｴ00ｨｦｨ ｨｹ ｨ ｨｮｨ ｨｪ ｨ 09ｨｪ0400ｨｦｨｺ05. 04ｨ 09ｨｹ05ｨ ｨ , 07 ｨ ｨｮｨｨ02ｨｪ07ｨｰ 0006ｨｨ04ｨｺ02 ｨ 09 ﾂｨｦｨｺ05 ｨｮ02 02ｨｪ ｨｦｨ ｨ 00ｨｴ0007 ｨｬ ｨｺ07ｨｪｨ 03ｨｹ0504 (400 mg 07 3) 08ｨ ｨ ｨｬ02 ｨｺ ｨｦｨ 06ｨｹｨｪ04 ｨｺｨ ｨｦ ｨｬ ｨ 08ｨｹ 01ｨｦ07ｨｬ ｨｮ02 abelcet (05ｨｦ08ｨｦ01ｨｦｨｺｨｹ ｨｮ05ｨｬ ｨｬｨ ｨ ｨｬ ｨｦｨｺ08ｨｪ04ｨｰ) 200 mg ｨ ｨｪ05 04ｨｬ0609ｨ, 02ｨｪ06 01ｨｦｨ ｨｺｨｹ0804ｨｺ ｨｺ07ｨｪｨ 03ｨｹ ｨ ｨｨ0209ｨ ｨ ｨｬ02 abelcet, 07 ｨ ｨｮｨｨ02ｨｪ07ｨｰ 0102ｨｪ 08ｨ 0906ｨｬ02ｨｦｨｪ ｨ ｨｰ. 09ｨｪ00ｨｦｨｨ0600ｨｴｨｰ, ｨｮ00ｨｦｨｰ 10/10/ ｨｬ0205ｨｪｨｦｨｮ ｨｹ 40 紊 ｨｺｨ ｨｦ 5ｨC6 01ｨｦｨ ｨｲｨｺ06ｨｰ ｨｺ02ｨｪ06ｨｮ02ｨｦｨｰ. 0000ｨｦｨｪ ｨ ｨｬｨｬｨ 00ｨｦｨｮｨｬｨｹｨｰ 00ｨｦｨ 00ｨ ｨｮ000907ｨｮｨｺ0708ｨｦｨｺｨｹ/ｨｺ070507ｨｪ07ｨｮｨｺ0708ｨｦｨｺｨｹ ﾂ ｨｦｨｰ 12/10/ ｨｦｨｪ02 04 ｨｺ070507ｨｪ07ｨｮｨｺｨｹ0804ｨｮ04, ｨｺｨ ｨｪ ｨ 01ｨｦｨ 08ｨｦｨｮ0006ｨｨ04ｨｺｨ ｨｪ ｨｮ ｨｹ-ｨ ｨｪｨｦｨｹｨｪ-0200ｨｺ0509ｨｮｨｦ07-ｨｺｨ 00ｨｦｨｹｨｪ ｨｺｨｹ0507ｨｪ ｨｺｨ ｨｹ080701ｨｰ ｨｬ07ｨｪ070902ｨｦｨｰ ｨｰ ｨｺｨ ｨｦ, ｨｮ0100ｨｺ02ｨｺ09ｨｦｨｬ06ｨｪｨ, ｹ1- ﾂ02ｨｦ02ｨｰ ｨｬ ｨｮ04 ｨｺｨ ｨｦ ｨｺ02ｨｪ0009ｨｦｨｺ ｨｺｨｴｨｮ04, ｨ 08 ｯ ｨｹ ｨｨ04ｨｮｨ ｨｪ 09ｨｦ ｨｰ ｨｺｨ ｨｦ 0002ｨｬ05 ﾂｨｦ ｨｪｨｪ0700ｨｹｨｪ ｨｰ ｨ ｨｮ04 00ｨｦｨ CMV ｨｬ02 PCR ｨ ｨｮｨｬｨ 0004ｨｰ PCR 0700ｨ ｨｪ ｨｨ0200ｨｦｨｺｨｹ 00ｨｦｨ CMV ｨｺｨ ｨｦ 07 ｨ ｨｮｨｨ02ｨｪ07ｨｰ 0006ｨｨ04ｨｺ02 ｨｮ02 ｨ 00ｨｴ0007 ｨｬ02 ganciclovir (Cymevene) 500 mg ｨ 08ｨｹ 01ｨｦ07ｨｬ ｨ 0906ｨｬ02ｨｦｨｪ02 ｨ ｨｰ ｨｺｨ ｨｦ ｨ ｨｪ ｨｺ02ｨｦｨｬ02ｨｪｨｦｨｺ ｨｴｨｮ04 ｨｺｨ ｨｦ ﾂ060904ｨｮ ｨｦｨ ｨｲｨｺ0705 ｨｮ01ｨｪ0109ｨｹｨｬ ｨｦｨｰ 26/10/ ｨ ｨｪｨ ｨｨ04ｨｺ02 04 ｨｺ070507ｨｪ07ｨｮｨｺｨｹ0804ｨｮ04, ｨｮ0004ｨｪ ｨ 01ｨｦｨ 08ｨｦｨｮ0006ｨｨ04ｨｺ02 ｨｹ00ｨｦ ｨｪｨｪ0700ｨｹｨｪ07ｨｰ ｨ ﾂ0607ｨｰ 02ｨｪ00060ｹ ｨ ｨｪ 0201ｨｮｨｦ ｨｦｨｺｨｹｨｰ ｨｮ02 ｨｹ ｨｬ07ｨｺ07ｨｰ ｨ ｨｮｨｨ02ｨｪ07ｨｰ ｨｮ01ｨｪ06- ﾂｨｦｨｮ02 per os ｨ 00ｨｴ0007 ｨｬ02 ganciclovir, ｨｬ ｨｴｨｮ ｨｰ ｨｺｨ 0005ｨｮ00ｨ ｨｮ07ｨｰ ｨｬ02ｨｦ06ｨｪ0200ｨ ｨｦ ｨｹ00ｨｦ 07 ｨ ｨｮｨｨ02ｨｪ07ｨｰ ｨｮ00ｨｦｨｰ 29/11/ ｨ ｨｮ08ｨ ｨｮ ｨ CD4 0502ｨｬ0207ｨｺ ｨｴｨｪ 122 ｨｺ/ｨｬL ｨｺｨ ｨｦ ｨ 09ｨｪ0400ｨｦｨｺ ｨｮ0700ｨｦｨｺ07 ｨｬ ｨｮ04 00ｨｦｨ HIV-1-RNA ｨｮ ｨｮｨｬｨ, 02ｨｪ06 ｨｮ00ｨｦｨｰ 19/3/ ｨ CD4 0700ｨ ｨｪ 19 ｨｺ/ｨｬL ｨｺｨ ｨｦ 0007 HIV-1-RNA ｨ 09ｨｪ0400ｨｦｨｺｨｹ. 04ｨｮ07ｨｪ ｨ ｨｮ0007ｨｪ ﾂ ｨ ｨｪ ｨｦｨｺ0705, ｨｮ00ｨｦｨｰ 29/3/ ｨｨ04ｨｺ02 00ｨ ｨｮ ｨｦ01ｨ ｨｺｨ ｨｦ 2ｨC ｨｺｨｴ ｨｦｨ ｨｴ0102ｨｺｨ 01ｨ ｨｺ ｨ ｨｮｨｨ02ｨｪ07ｨｰ ｨｬ ｨ 08ｨｹ 8 ｨｬ07ｨｪ02ｨｰ 02ｨｬ0205ｨｪｨｦｨｮ ｨｬ02ｨｴｨｬｨ ｨｬｨ 05ｨ ｨｺ06ｨｪ ｨｬ070908ｨｴｨｪ ｨ 09ｨｦｨｮ ｨｰ ｨｺ0500ｨｴ 00ｨｪ05ｨｨ0701 ｨｺｨ ｨｦ ｨｮ0004 ｨｮ01ｨｪ06 ﾂ02ｨｦｨ ｨ ｨｴｨｮ02. 08ｨ ｨｦ0509ｨｺ02ｨｦｨ 0004ｨｰ ｨｪ07ｨｮ ｨ ｨｰ ｨ ｨｮｨｨ02ｨｪ0705ｨｰ ｨｮ0004ｨｺｨ ｨｪ 00ｨ ｨｰ ｨｬｨ 00ｨ : ｨ 08ｨｬｨ, ｨ, ｨｬ010205ｨｹｨｰ 00ｨｴｨｪ 07ｨｮ0006ｨｪ, 0105ｨｦｨｺｨｹ 00ｨ ｨｮ000907ｨｮｨｺｨｹ0804ｨｮ04ｨｰ, ｨｦｨｮ00ｨｹｨｰ ｨ 08ｨｹ 06ｨｪ ｨｺｨ ｨｦ ｨｮ00ｨｹｨｬｨ ﾂ07, ｨｺ02ｨｦｨｬ06ｨｪ0701 ｨｪ0ｹ1ｨ ﾂｨｨ0705ｨｪ 00ｨｦｨ CMV, Mycobacterium tuberculosis (0800), Legionella, Chlamydia pneumoniae, Pneumocystis carinii, Aspergillus spp ｨｺｨ ｨｦ HSV (0808ｨｪ. 2). 0701ｨｪ070800ｨｦｨｺ05, ｨ ｨｮ08ｨ 00ｨｴｨｪ 0102ｨｦ00ｨｬ0500ｨｴｨｪ ｨｦ0208 ﾂｨ ｨｪ ｨｪ0ｹ1ｨｪｨ ( ｨ ｨｺｨ ｨｦ 0105ｨｦｨｺｨｹ 00ｨ ｨｮ000907ｨｮｨｺｨｹ0804ｨｮ04ｨｰ) 0600ｨｦｨｪ02 ｨｬ ﾂ0907ｨｮ04 NALC (N-acetyl-L-cysteine), ｨｮ05ｨｬ02ｨｴｨｪｨ ｨｬ ｨｰ Nolte ｨｺｨ ｨｦ Metchock (1993). 7 08ｨ ｨｬ07ｨｪ ｨｪｨ ｨｺ050000ｨ 09ｨ ｨ 08ｨｹ 0007 ｨ 08ｨｬｨ ｨｺｨ ｨｦ 0007 ｨｬ010205ｨｹ 00ｨｴｨｪ 07ｨｮ0006ｨｪ ｨ 0807ｨｬ07ｨｪ06ｨｨ04ｨｺｨ ｨｪ ｨｬ ﾂ0907ｨｮ04 Biocoll Separating Solution (Biochrom AG) DNA ｨ 08ｨｹ 00ｨ ｨ, ｨｦｨｺｨｹ 00ｨ ｨｮ000907ｨｮｨｺｨｹ0804ｨｮ04ｨｰ, 0007 ｨ 08ｨｬｨ ｨｺｨ ｨｦ 0007 ｨｬ010205ｨｹ 00ｨｴｨｪ 07ｨｮ0006ｨｪ ｨ 0807ｨｬ07ｨｪ06ｨｨ04ｨｺ02, ｨｮ0004 ｨｮ01ｨｪ06- ﾂ02ｨｦｨ, ﾂ0904ｨｮｨｦｨｬ070807ｨｦ06ｨｪ00ｨ ｨｰ 0007 Talent seek viral DNA extraction kit, 02ｨｪ DNA ｨ 08ｨｹ 00ｨ ｨｬｨ 00ｨ ｨｦｨｮ0006ｨｪ ｨ 0807ｨｬ07ｨｪ06ｨｨ04ｨｺ02 ｨｬ ｨｬ06ｨｨ ｨｴ0002ｨｲｨｪ05ｨｮ04ｨｰ 08/SDS 02ｨ ｨｦｨｪｨｹ0504ｨｰ/ ﾂ05ｨｴ090702ｨｹ09ｨｬｨｦ ｨｴ05ｨｦｨ ｨｮｨｬ06ｨｪ0403 PCR, ｨ ｨｺ ｨｨ04ｨｮ02, 0600ｨｦｨｪ02 ｨｮ ｨｦｨｺｨｹ ｨｹ00ｨｺ07 50 ｨｬL ｨｺｨ ｨｦ ｨｦ0208 ﾂ02 20 mm Tris HCl (ph 8,4), 50 mm KCl, 1,5 mm MgCl 2, 200 ｨｬM ｨ 08ｨｹ ｨｺ05ｨｨ02 dntp, 1,5 U Taq ｨｬ020905ｨｮ04 (Invitrogen, The Netherlands), 200 pm 02ｨｺｨｺｨｦｨｪ040006ｨｰ (MWG). 03ｨｦ ｨ ﾂ0802ｨｰ 00ｨｴｨｪ 02ｨｺｨｺｨｦｨｪ040006ｨｪ ﾂ07ｨｪ00ｨ ｨｪ ｨ 08ｨｹ ｨｬ02ｨｪ02ｨｰ 0104ｨｬ07ｨｮｨｦ0205ｨｮ02ｨｦｨｰ. 17ｨC23 05 ｨ ｨｪ050501ｨｮ04 00ｨｴｨｪ ｨ ｨｮｨｬ0500ｨｴｨｪ 0004ｨｰ PCR 0600ｨｦｨｪ02 ｨｬ ｨｺ ｨｹ0904ｨｮ04 00ｨｴｨｪ ｨｲｨｹｨｪ00ｨｴｨｪ ｨｮ ｨｺ00ｨｴｨｬｨ ｨ 00ｨ 09ｨｹ0304ｨｰ, ｨｦ0208 ﾂ ｨｴｨｬｨｦ0705 ﾂ07 ｨ ｨｦｨｨ0801ｨｦ07 ｨｮ02 ｨｮ0100ｨｺ06ｨｪ0009ｨｴｨｮ04 10ｹ1 ｨｬg/mL, 02ｨｪ06 00ｨｦｨ 0004ｨｪ ｨｦｨｺ07 08ｨ 09ｨ ｨｮ04 00ｨｴｨｪ ｨ 08ｨｴｨｪ ﾂ0904ｨｮｨｦｨｬ070807ｨｦ07ｨｨ04ｨｺ02 ｨｮ01ｨｮｨｺ ｨｺ0807ｨｬ0807ｨｰ ｨｦ ｨｰ ｨ ｨｺ00ｨｦｨｪ ｨ ｨｰ 0ｹ1(UV). 0408ｨｪｨ ｨｺｨ ｨｰ 1. 00ｨｦｨｺ ｨ ｨｪｨｦｨｮｨｬ0708 ｨｺｨ ｨｦ 0007ｨｪ0801ｨｦｨ ﾂ0904ｨｮｨｦｨｬ070807ｨｦ07ｨｨ04ｨｺｨ ｨｪ ｨｮ0004ｨｪ PCR0ｹ1. 00ｨｦｨｺ ｨ ｨｪｨｦｨｮｨｬｨｹｨｰ 0107ｨｪ0801ｨｦ07 09ｨｪｨ CMV IE Shibata, M. tuberculosis IS6110 Marcheti et al, Legionella Lmip Koide & Saito, Chlamydia pneumoniae MOMP Kaltenboeck et al, Pneumocystis carinii ｨｬ07ｨｪ0501ｨ mt rrna Weig et al, Aspergillus 18s rrna Skladny et al, HSV UL42 Hirsch & Bossart,

3 ﾁ (20)3, ｨｪｨ ｨｺｨ ｨｰ ﾂ07ｨｰ 00ｨｦｨ 08ｨ ｨｨ0700ｨｹｨｪ0701ｨｰ ｨｬｨｦｨｺ ｨ ｨｪｨｦｨｮｨｬ0705ｨｰ ｨｺｨ ｨｦ ｨ 0802ｨｦｨｺ07ｨｪｨｦｨｮ000ｹ1ｨｦｨｺ ｨｬｨ 00ｨ. PCR 05ｨｬ020907ｨｬ04ｨｪ08ｨ 0905ｨｦｨｺｨｹ ｨｦｨｺ07ｨｪｨｦｨｮ00ｨｦｨｺ05 CMV 09ｨｪ050501ｨｮ ｨｦ 0800 HSV ｨ ｨｮｨｬｨ 00ｨ ｨ ﾂ08ｨ ｨｰ ｨｬｨｦｨｺ0907- DNA CMV ｨ ｨｪｨｦｨｮｨｬ /10/ ｨｬｨ + ｨC ｨC 05/10/ ｨ + ｨC ｨC 12/10/ ｨｮ00ｨｹｨｰ 02ｨｪ ｨ ｨｺ06ｨｪ + wt ｨC ｨC 12/10/ ｨｮ00ｨｹｨｰ ｨｮ0007ｨｬ05 ﾂ ｨC 27/10/ ｨｮ08ｨ 0205ｨｺ06ｨｪ 13/03/ ｨｦｨｺｨｹ 00ｨ ｨｮ000907ｨｮｨｺｨｹ0804ｨｮ04ｨｰ + wt/mt ｨC 19/03/ ｨｹｨｰ + wt/mt ｨC ｨC + : ｨｦｨｺｨｹｨｰ ｨC : 0909ｨｪ0400ｨｦｨｺｨｹｨｰ NE: 0202ｨｪ ｨｬｨ wt: 0001ｨｮｨｦ ｨｦｨｺｨｹ ｨｮ ﾂ07ｨｰ 09D169 mt: ｨ 0505ｨ 00ｨｬ06ｨｪ07 ｨｮ ﾂ07ｨｰ C8702 ｨｮ0007 ｨｺｨｴ01ｨｦｨｺｨｹｨｪｨｦ07 594: A05ｨ ｨｪ08ｨｪ ｨ 0508ｨｪ04 (GCG03GTG) ｨｦ ｨｬｨｦｨｺ ｨ ｨｪｨｦｨｮｨｬ0708: Legionella, Chlamydia pneumoniae, Pneumocystis carinii, Aspergillus 01ｨｦｨ ｨｪｨ 01ｨｦｨ 08ｨｦｨｮ00ｨｴｨｨ0208 ｨ ｨｪ 0007 ｨｮ ﾂ07ｨｰ CMV ｨ ｨｪｨｦ ﾂｨｪ0205ｨｨ04ｨｺ02 ｨｬ ｨｪ ｨｰ ｨｬｨｴ0604ｨｰ ｨ ｨｮｨｨ02ｨｪ0705ｨｰ 0700ｨ ｨｪ ｨ ｨｪｨｨ02ｨｺ00ｨｦｨｺｨｹ ｨｮ ｨｬｨ ｨｺ ﾂ ｨｨ04ｨｺ02 (ganciclovir), 0600ｨｦｨｪ02 ｨ ｨｪ050501ｨｮ04 ｨ ﾂ08ｨ ｨｰ DNA (sequencing) ｨｪｨｦ UL97. 01ｨｦｨ 0004ｨｪ 02ｨｺ0502ｨｺ00ｨｦｨｺ07 02ｨｪ08ｨｮ ﾂ01ｨｮ ｨｪｨｦ UL97 ﾂ0904ｨｮｨｦｨｬ070807ｨｦ07ｨｨ04ｨｺｨ ｨｪ 07ｨｦ 02ｨｺｨｺｨｦｨｪ040006ｨｰ ｨｺｨ ｨｦ 07ｨｦ ｨｮ01ｨｪｨｨ07ｨｺ02ｨｰ ｨ 08ｨｹ ｨｬ02ｨｪ04 ｨｬ H ｨ ｨｪ0500ｨｪｨｴｨｮ ｨｰ ｨ ﾂ08ｨ ｨｰ DNA 0600ｨｦｨｪ02 ｨｮ0007ｨｪ DNA ｨ ｨｪｨ ABI Prism ｨｦ ｨ ﾂ0802ｨｰ DNA, ｨｺ0103ｨ ｨｪ, ｨｬ ｨｨ04ｨｺｨ ｨｪ ｨｺｨ ｨｦ ｨｮ0007ｨｦ ﾂ07ｨｨ04ｨｺｨ ｨｪ ｨｬ02 00ｨｦｨｰ ｨ ﾂ0802ｨｰ ｨｪｨｦ UL97 ｨ 08ｨｹ ｨｮｨｦ ｨｦｨｺｨｹ ｨｺｨ ｨｦ ｨｬ0200ｨ 0505ｨ 00ｨｬ06ｨｪ07 ｨｮ ﾂ07ｨｰ AD169 ｨｺｨ ｨｦ C8702, 10 ｨ ｨｪ0008ｨｮ0007ｨｦ ﾂｨ, ﾂ0904ｨｮｨｦｨｬ070807ｨｦ06ｨｪ00ｨ ｨｰ ｨｹ0009ｨ ｨｬｨｬｨ SEQUENCHERa. A KAI 07 ﾁ ｨ ｨ ｨｮｨｬｨ 00ｨ ｨ ｨｰ 0004ｨｰ ｨｬ ｨｰ ｨｮ0100ｨｺ02ｨｪ000906ｨｪ07ｨｪ00ｨ ｨｦ ｨｮ0007ｨｪ 0808ｨｪｨ ｨｺｨ ｨｴｨｰ 02ｨ 08ｨｪ0200ｨ ｨｦ, 0007 DNA CMV ｨ ｨｪｨｦ ﾂｨｪ ｨｺ02 ｨｮ02 ｨｹ05ｨ 00ｨ ｨｬｨ 00ｨ ｨｮ0004ｨｺｨ ｨｪ ｨｮ00ｨｦｨｰ 01ｨｦｨ ｨｦｨｺ06ｨｰ ﾂ0907ｨｪｨｦｨｺ06ｨｰ ｨｦｨｹ010701ｨｰ 0004ｨｰ ｨｪ07ｨｮ ｨ ｨｰ ｨ ｨｮｨｨ02ｨｪ0705ｨｰ, 01ｨｦ0509ｨｺ02ｨｦｨ ｨｰ 4 ｨｬ04ｨｪ06ｨｪ. 09ｨｪ0008ｨｨ0200ｨ, 0102ｨｪ ｨ ｨｪｨｦ ﾂｨｪ0205ｨｨ04ｨｺ ｨｪ0200ｨｦｨｺｨｹ 0105ｨｦｨｺｨｹ 00ｨｴｨｪ ｨｴｨｪ ｨｬｨｦｨｺ ｨ ｨｪｨｦｨｮｨｬ06ｨｪ ｨｮ0004ｨｺｨ ｨｪ ｨｺ02ｨｦｨｬ06ｨｪ0701 ｨｪｨ 0002ｨｺｨｬ0409ｨｦｨｴｨｨ ｨ 0800ｨｦ ｨｬ ｨ ｨｮｨｨ02ｨｪ0705ｨｰ ｨ 08ｨｹ ｨ ｨｰ ｨｰ ｨｬｨｦｨｺ ｨ ｨｪｨｦｨｮｨｬ0705ｨｰ ｨ ｨｪ ｨ 0800ｨｦｨ 0201ｨｺｨ ｨｦ09ｨｦｨ ｨｺ06ｨｪ 0507ｨｦｨｬ060602ｨｴｨｪ 00ｨｦｨ HIV-1(+) ｨ ｨｮｨｨ02ｨｪ0208ｨｰ. 13ｨC ｨｮ04ｨｬｨ ｨｪ00ｨｦｨｺｨｹ ｨｬｨ 0004ｨｰ 08ｨ ｨｮｨ ｨｰ ｨｬ ｨｰ 0208ｨｪｨ ｨｦ 04 ｨ ｨｪ ｨｮ ｨｪ0200ｨｦｨｺ ｨｦｨｺ CMV ｨｮ00ｨ 0605ｨｺ ｨｺｨｹ050701, ｨｮ ｨｮ ｨｦ010208ｨｪｨｴｨｮ04ｨｰ 0004ｨｰ ｨｺｨ 0005ｨｮ00ｨ ｨｮ04ｨｰ ｨ ｨｮｨｨ02ｨｪ0705ｨｰ (02ｨｦｨｺ. 1ｨ, 00). 03 Goodgame, ｨｮ02 ｨｬｨｦｨ ｨｮ0100ｨｺ09ｨｦ00ｨｦｨｺ07 ｨｬ , ﾂ0904ｨｮｨｦｨｬ070807ｨｦ06ｨｪ00ｨ ｨｰ ｨ ｨｪ07ｨｮ07ｨｲｨｮ0007 ﾂ04ｨｬ0208ｨ, ｨｺｨ 0505ｨｦ ｨｦｨ ｨｺｨ ｨｦ PCR 00ｨｦｨ CMV ｨｮ ｨｦ ｨｰ ｨ 08ｨｹ 0007 ｨｺｨｹ0507ｨｪ, ｨｺｨ ｨｮ0007 ｨｮ01ｨｬ080609ｨ ｨｮｨｬｨ ｨｹ00ｨｦ 04 PCR ｨ ｨ ﾂ0208ｨ ｨｬ06ｨｨ070107, ｨｬ ｨ ｨｦｨｮｨｨ04ｨｮ08ｨ ｨｺｨ ｨｦ ｨｦｨｺｨ ｨｪ070807ｨｦ0400ｨｦｨｺ07 02ｨｦ01ｨｦｨｺｨｹ000400ｨ. 00ｨｦｨ ｨｬ0200ｨ 0002ｨｪ06ｨｮ ｨｮ0100ｨｺ09ｨｦ00ｨｦｨｺ07 ｨｬ ｨｬ02 21 ｨｬ0200ｨ ｨｬ07ｨｮ ﾂ0201ｨｬ06ｨｪ0701ｨｰ ｨｦ0602 ｨｹ00ｨｦ 04 PCR ｨｮ01ｨｪ0609ｨ 0502 ｨ ｨ ｨｮｨｦｨｮ00ｨｦｨｺ05 ｨｮ0004ｨｪ ｨｦｨｬ04 ｨ ｨｪ08 ﾂｨｪ0201ｨｮ04 CMV ｨｮ0007 ｨｬｨｹ-ｨｮ ﾂ0201ｨｬｨ ｨｪ 08ｨ ｨｮｨ ｨｬ , 04 ｨ ｨｪ08 ﾂｨｪ0201ｨｮ04 DNA CMV ｨｮ ｨｦｨｺｨｹ 00ｨｴｨｪ ﾂｨ 09ｨ ｨｺ000409ｨｦｨｮ00ｨｦｨｺ06ｨｪ ｨ 0802ｨｦｨｺ07ｨｪｨｦｨｮ00ｨｦｨｺ06ｨｪ 0905ｨ 0906ｨｪ (02ｨｦｨｺ. 1ｨ ) ｨｪ ｨ ｨｦ0008ｨ ｨ ｨｪ 00ｨｴｨｪ ｨ ｨｦ06ｨｮ02ｨｴｨｪ. 0408ｨｴｨｰ 02ｨ 08ｨｪ0200ｨ ｨｦ ｨ 08ｨｹ 00ｨ ｨ 0802ｨｦｨｺ07ｨｪｨｦｨｮ00ｨｦｨｺ05 ｨ ｨｮｨｬｨ 00ｨ (02ｨｦｨｺ. 109), 08ｨ 09ｨ ｨｨ04ｨｺ ｨｮ ｨｰ CMV ｨｬｨｴ0604ｨｰ ｨｺｨ ｨｦ, ｨｮ0004 ｨｮ01ｨｪ06 ﾂ02ｨｦｨ, ｨｰ ｨｺ02ｨｦｨｬ06ｨｪ0701 ｨｪｨ 01ｨｦ ｨｪ04ｨｨ0208 ｨ ｨｪ ｨｮ00ｨｦｨｰ 13/ 3/ ｨｦ05ｨｹ00ｨ ｨｪ ｨｮ ｨ ｨｪｨ ｨｬｨｴ0604 ( ｨｮ ﾂ07ｨｰ) 07 ｨｮ0004ｨｪ 02ｨｬ0205ｨｪｨｦｨｮ04 ｨ ｨｪｨｨ02ｨｺ00ｨｦｨｺ06ｨｪ ｨｮ ﾂ06ｨｪ 05ｨｹ00ｨｴ 0004ｨｰ ｨｨ0209ｨ ｨ ｨｰ, 0600ｨｦｨｪ02 ｨ ｨｪ050501ｨｮ04 ｨｪ0701ｨｺ ｨｦ01ｨｦｨｺ07ｨｰ ｨ ﾂ08ｨ ｨｰ DNA (sequencing). 0700ｨ 01ｨｦｨ ｨｨ06ｨｮｨｦｨｬｨ ｨｬｨ 00ｨ ｨ 08ｨｹ 00ｨｦｨｰ 13/3/2000 ｨｺｨ ｨｦ 19/3/ ｨｨ04ｨｺｨ ｨｪ ｨ ｨｪｨｨ02ｨｺ00ｨｦｨｺ05 ｨｮ ﾂ04 ｨｮ ｨｮ07ｨｮ00ｨｹ 50% (0808ｨｪ. 2, 02ｨｦｨｺ. 2), ｨｬ ﾂｨ 09ｨ ｨｺ000409ｨｦｨｮ00ｨｦｨｺ07 ｨｬ0200ｨ 0505ｨ 0007 V594 ｨｮ ｨｪ0801ｨｦ07 UL97. 03ｨｦ 08ｨｦ07 ｨｮ04ｨｬｨ ｨｪ00ｨｦｨｺ06ｨｰ ｨｬ0200ｨ 0505ｨ 0006ｨｰ ｨｮ ｨｪ0801ｨｦ07 UL97, ｨｮ ｨｪ ｨ ｨｪｨｨ02ｨｺ00ｨｦｨｺｨｹ000400ｨ ｨｮ02 ganciclovir, ｨｦ ｨｪ00ｨ ｨｦ ｨ 08ｨｹ ｨｰ Chou et al (1995) 10 ｨｺｨ ｨｦ ﾂｨ ｨ ｨｪ00ｨ ｨｦ ｨｬ0200ｨ ｨｴｨｪ ｨｺｨｴ01ｨｦｨｺ07ｨｪ08ｨｴｨｪ 591 ｨｺｨ ｨｦ ｨC ｨｦｨ 0808ｨｮ00ｨｴｨｮ04 00ｨｴｨｪ ｨ ｨｪｨｨ02ｨｺ00ｨｦｨｺ06ｨｪ ｨｮ ﾂ06ｨｪ ｨ ｨｬｨ ｨ ｨｰ 0004ｨｰ ｨ ｨｪｨ ｨｬｨｦｨｺ07ｨｰ ｨｬ ｨｰ ｨｺｨ ｨｦ ｨｪ ｨ ｨｮｨｨ02ｨｪ0705ｨｰ. 0908ｨｹ 0004ｨｪ ｨ ｨｪ050501ｨｮ ｨｰ DNA ｨ ﾂ08ｨ ｨｰ ｨｨ04ｨｺｨ ｨｪ ｨｮ04ｨｰ ｨｬ070902ｨｦｨｮｨｬ0708 ｨｮ00ｨ ｨｺｨｴ01ｨｦｨｺｨｹｨｪｨｦｨ 579 (GGC03GGT) ｨｺｨ ｨｦ 598 (GGT03GGC) ｨｮ02 ｨｹ05ｨ 00ｨ ｨｬｨ 00ｨ ｨ 08ｨｹ 00ｨｦｨｰ 12/10/ ｨｦ ｨｬ070902ｨｦｨｮｨｬ ｨｪ0701ｨｪ ｨｹ00ｨｦ 0102ｨｪ ｨ ｨｪｨ ｨｬｨｹ0501ｨｪｨｮ04 ｨｺｨ ｨｪ ｨｬ080209ｨ ｨｮｨｬｨ 00ｨｦｨｺ05, 04 ﾂ0907ｨｮ04 ｨｬ02ｨｨｨｹ01ｨｴｨｪ ｨｬ0709ｨｦｨ ｨｺ07ｨｰ 09ｨｦ ｨ ｨｰ 09ｨ ｨｮｨｦｨｮｨｬ06ｨｪｨｴｨｪ ｨｮ0004ｨｪ PCR, ｨｮ02 ｨｮ01ｨｪ0101ｨ ｨｮｨｬｨｹ ｨｬ02 00ｨ ｨ 0802ｨｦｨｺ07ｨｪｨｦｨｮ00ｨｦｨｺ ｨｬｨ 00ｨ, ｨ ｨｦｨｬ ｨ ｨｮ0004ｨｪ 0600ｨｺｨ ｨｦ ｨｦ0500ｨｪｨｴｨｮ ｨｰ CMV ｨｬｨｴ0604ｨｰ ｨｮ04ｨｰ, ｨｹ08ｨｴｨｰ ｨｮ0004ｨｪ

4 13314 ARCHIVES OF HELLENIC MEDICINE 20(3), 2003 ｨ bp bp ｨｦ ｨｦｨｺｨｹｨｪｨ 1. A0802ｨｦｨｺ07ｨｪｨｦｨｮ00ｨｦｨｺ ｨｬｨ 00ｨ. (ｨ ) ｨｦ06ｨｮ02ｨｦｨｰ CMV ｨｬｨｴ0604ｨｰ ｨｮ02 ｨｺ070507ｨｪ07ｨｮｨｺｨｹ0804ｨｮ HIV-1(+) ｨ ｨｮｨｨ02ｨｪ0705ｨｰ. (09) 0001ｨｮｨｦ ｨｦｨｺ07 02ｨｬ0205ｨｪｨｦｨｮ ｨｺｨｹ ｨｬ ｨ 08ｨｹ ｨｨ0209ｨ ｨ 00ｨｦｨ CMV. (00) ｨｺ ｨｹ0904ｨｮ ｨｲｨｹｨｪ00ｨｴｨｪ 0004ｨｰ ｨ ｨｪ ｨ ｨｮ04ｨｰ PCR ｨｮ ｨｺ00ｨｴｨｬｨ ｨ 00ｨ 09ｨｹ0304ｨｰ 2%. 0702ｨｦ0905 1: 0102ｨｪ0200ｨｦｨｺｨｹ 0105ｨｦｨｺｨｹ ｨ 08ｨｹ 00ｨｦｨｰ ｨ ｨｦ06ｨｮ02ｨｦｨｰ, ｨｨ0200ｨｦｨｺｨｹ 00ｨｦｨ CMV. 0702ｨｦ0905 2: 0909ｨｪ0400ｨｦｨｺｨｹｨｰ ｨｬ ｨ ｨｰ 00ｨｦｨ CMV. 0702ｨｦ0905 3: ｨｦｨｺｨｹｨｰ ｨｬ ｨ ｨｰ 00ｨｦｨ CMV 163 bp. 0702ｨｦ0905 4: ｨｺ0004ｨｰ ｨｬ0709ｨｦｨ ｨｺ ｨｰ 00ｨｬ04ｨｬ0500ｨｴｨｪ DNA ｨｺ02ｨｦｨｬ06ｨｪ ｨｴｨｮ04, 04 ｨ ｨｪ08 ﾂｨｪ0201ｨｮ04 ｨ ｨｪｨｨ02ｨｺ00ｨｦｨｺ06ｨｪ ｨｮ ﾂ06ｨｪ ｨｪ , 02ｨｪ ｨ ｨｮ04 00ｨ 0100ｨｹｨｮ04ｨｬｨｴｨｪ ｨｬ070902ｨｦｨｮｨｬ06ｨｪ ｨ 0807ｨｺ ｨｦ 0004ｨｪ 0208ｨ ｨｪｨ ｨｬｨｹ0501ｨｪｨｮ04. E09 ﾁ ｨｦ ｨｮ ｨ ｨｰ ｨｨ ｨｪ ｨｪｨ 02ｨｺ020905ｨｮ0701ｨｪ 00ｨｦｨｰ 0201 ﾂｨ 09ｨｦｨｮ000802ｨｰ ｨｰ ｨｰ ｨｦ ﾂｨ ｨｦｨ 0004 ｨｮ01ｨｬ ｨｮ0007 ｨｮ ﾂ0201ｨｦｨ ｨｮｨｬｨｹ 00ｨｴｨｪ 02ｨｦｨｺｨｹｨｪｨｴｨｪ. ｨ AAGCACGCCGGCGCGGCCTGCCGCGCGTTGGAGAACGGTAAGCTCACGC AD169 Lys His Ala Gly Ala Ala Cys Arg Ala Leu Glu Asn Gly Lys Leu Thr GTG C8702 Val 03ｨｦｨｺｨｹｨｪｨ 2. ﾁ09ｨｴｨｬｨ ｨｬｨｬｨ 00ｨ ｨｺｨ ｨｦ ｨ ﾂ0802ｨｰ DNA ｨｮ ﾂ06ｨｪ CMV. (ｨ ) ﾁ09ｨｴｨｬｨ 00ｨｹ0009ｨ ｨｬｨｬｨ 0201ｨｮｨｦ ｨｦｨｺ0705 ｨｮ ﾂ0701ｨｰ (12/10/2000) ｨｬ02 ｨ ﾂ08ｨ ｨｹｨｬ07ｨｦｨ ｨｬ ｨｮｨｦ ｨｦｨｺｨｹ ｨｮ ﾂ07ｨｰ AD169. (09) ﾁ09ｨｴｨｬｨ 00ｨｹ0009ｨ ｨｬｨｬｨ ｨ 08ｨｹ 0007 ｨｮ ﾂ07ｨｰ 0004ｨｰ 13/3/2001, ﾂｨｪ02ｨｦ 0004ｨｪ 0508ｨ ｨｰ ｨｬ0200ｨ 0505ｨ 0007ｨｰ (GCG03GTG), ｨｹｨｬ07ｨｦｨ ｨｰ ｨｬ ｨ ｨｪｨｨ02ｨｺ00ｨｦｨｺｨｹ ｨｮ ﾂ07ｨｰ C8702. (00) ﾂｨｦｨｮ04 ｨ ﾂｨｦ06ｨｪ 00ｨｴｨｪ AD169 ｨｺｨ ｨｦ C8702. ABSTRACT... Elucidation of cytomegalovirus infection and recurrence in a HIV-1(+) patient C. KOTTARIDI, 1 G. PLOUMIDIS, 2 E. GRAPSAS, 2 C. FERETIS, 3 P. BENAKIS, 3 P. FILALITHIS, 2 D. BOUZARELOU, 1 G. NASIOULAS 1 1 Department of Molecular Biology, ｰHygeia ｱ Research Center ｰAntonis Papayiannis ｱ, Athens, 2 1st Department of Internal Medicine, ｰHygeia ｱ Diagnostic and Therapeutic Center of Athens, 3 Department of Gastroenterology, ｰHygeia ｱ Diagnostic and Therapeutic Center of Athens, Greece Archives of Hellenic Medicine 2003, 20(3):311ｨC315 This study illustrates the power of molecular biology techniques based on PCR in the elucidation of cytomegalovirus (CMV) infection in a 0507V-1(+) patient. CMV is responsible for the most common viral opportunistic infection in patients with acquired immunodeficiency syndrome (AIDS). The colon is a common site of CMV infection in AIDS patients. Clinical diagnosis of CMV infection is based on the characteristic endoscopic appearance of extensive ulceration of the gastric mucosa. A 54 year-old homosexual man who had AIDS complicated by CMV visited the hospital because of high fever. PCR tests for Legionella, Chlamydia pneumoniae, Pneumocystis carinii and Aspergillus were negative. In addi-

5 ﾁ (20)3, tion, the patient presented with diarrhea and DNA prepared from biopsies of colon ulceration sampled on colonoscopy scored positive for CMV. Ganciclovir was administered, with good clinical response but diarrhea recurred six months later. PCR for CMV scored positive again and the emergence of CMV mutants conferring ganciclovir resistance was investigated. The presence for the most common mutations of the UL97 gene associated with ganciclovir resistance was directly assessed in DNA from the patient ｯs leukocytes. Direct sequencing of the PCR products revealed the known V594 mutation predisposing to ganciclovir resistance, and the same gene polymorphism (579, GGC03GGT and 598, GGT03GGC) in all samples tested. Finally the patient died. In summary, molecular biology methods can be used for early detection of CMV in characteristic colonic lesions in AIDS patients. Detection of mutant strains resistant to antiviral drugs and polymorphism may elucidate the natural history of the infection in the particular patient.... Key words: CMV, Ganciclovir, HIV-1, Resistance 00ｨｦ0905ｨｦ070009ｨ 0208ｨ 1. WU F, LI H, ZHANG DY. Differential detection of cytomegalovirus immediate-early messenger RNA in clinical samples using ligation-dependent PCR. Mol Diagn 2001, 6:233ｨC SALMON-CERON D. Cytomegalovirus infection: the point in HIV Med 2001, 2:255ｨC TENDERO DT. Laboratory diagnosis of cytomegalovirus (CMV) infections in immunodepressed patients, mainly in patients with AIDS. Clin Lab 2001, 47:169ｨC BINI EJ, GORELICK SM, WEINSHEL EH. Outcome of AIDS-associated cytomegalovirus colitis in the era of potent antiretroviral therapy. J Clin Gastroenterol 2000, 30:414ｨC MENTEC H, LEPORT C, LEPORT J, MARCHE C, HARZIC M, VILDE JL. Cytomegalovirus colitis in HIV-1-infected patients: a prospective research in 55 patients. AIDS 1994, 8:461ｨC GOODGAME RW, GENTA RM, ESTRADA R, DEMMLER G, BUFFONE G. Frequency of positive tests for cytomegalovirus in AIDS patients: Endoscopic lesions compared with normal mucosa. Am J Gastroenterol 1993, 8:338ｨC NOLTE FS, METCHOCK B, MCGOWAN JE JR, EDWARDS A, OKWUM- ABUA O, THURMOND C ET AL. Direct detection of Mycobacterium tuberculosis in sputum by polymerase chain reaction and DNA hybridization. J Clin Microbiol 1993, 31:1777ｨC KUSNE S, MANEZ R, FRYE BL, ST GEORGE K, ABU-ELMAGD K, TABAS- CO-MENGUILLON J ET AL. Use of DNA amplification for diagnosis of cytomegalovirus enteritis after intestinal transplantation. Gastroenterology 1997, 112:1121ｨC COTTE L, DROUET E, BISSUEL F, DENOYEL GA, TREPO C. Diagnostic value of amplification of human cytomegalovirus DNA from gastrointestinal bi07psies from human immunodeficiency virusinfected patients. J Clin Microbiol 1993, 31:2066ｨC CHOU S, ERICE A, COLIN JORDAN M, VERCELLOTTI GM, MICHELS KR, TALARICO CL ET AL. Analysis of the UL97 phosphotransferase coding sequence in clinical cytomegalovirus isolates and identification of mutations conferring ganciclovir resistance. JID 1995, 171:576ｨC CHOU S, GUENTZEL S, MICHELS KR, MINER RC, LAWRENCE DREW W. Frequency of UL97 phosphotransferase mutations related to ganciclovir resistance in clinical cytomegalovirus isolates. JID 1995, 172:239ｨC MENTEZ JC, SIA IG, TAU KR, ESPY MJ, SMITH TF, CHOU S ET AL. Novel mutation in the CMV UL97 gene associated with resistance to ganciclovir therapy. Transplantation 1999, 67:755ｨC MONNO R, MAGGI P, CARBONARA S, SIBILIO G, D ｯAPRILE A, COSTA D ET AL. Chlamydia trachomatis and Mycobacterium tuberculosis lung infection in a HIV-positive homosexual man. AIDS Care STDS 2001, 15:607ｨC MYLONAKIS E, BARLAM TF, FLANIGAN T, RICH JD. Pulmonary aspergillosis and invasive disease in AIDS: review of 342 cases. Chest 1998, 114:251ｨC LLOYD A. HIV infection and AIDS. P N G Med J 1996, 39:174ｨC MANIATIS ET AL. Molecular cloning. A laboratory manual. Appendix E HIRSCH H, BOSSART W. Two-center study comparing DNA preparation and PCR amplification protocols for herpes simplex virus detection in cerebrospinal fluids of patients with suspected herpes simplex encephalitis. J Med Virol 1999, 57:31ｨC KOIDE M, SAITO A. Diagnosis of Legionella pneumophila infection by polymerase chain reaction. Clin Infect Dis 1995, 21:199ｨC KALTENBOECK B, KOUSOULAS K, STORZ J. Two-step polymerase chain reactions and restriction endonuclease analyses detect and differentiate ompa DNA of Chlamydia spp. J Clin Microbiol 1992, 30:1098ｨC SKLADNY H, BUCHHEIDT D, BAUST C, KRIEG-SCHNEIDER F, SEIFARTH W, LEIB-MOSCH C ET AL. Specific detection of Aspergillus species in blood and bronchoalveolar lavage samples of immunocompromised patients by two step PCR. J Clin Microbiol 1999, 37:3865ｨC WEIG M, KLINKER H, BOGNER BH, MEIER A, GROSS U. Usefulness of PCR for diagnosis of Pneumocystis carinii pneumonia in different patient groups. J Clin Microbiol 1997, 35:1445ｨC MARCHETTI G, GORI A, CATOZZI L, VAGO L, NEBULONI M, ROSSI MC ET AL. Evaluation of PCR detection of Mycobacterium tuberculosis from formalin-fixed, paraffin-embedded tissues: Comparison of four amplification assays. J Clin Microbiol 1998, 36:1512ｨC SHIBATA M, MORISHIMA T, TERASHIMA M, KIMURA H, KUZUSHIMA K, HANADA N ET AL. Human cytomegalovirus infection during childhood: detection of viral DNA in peripheral blood by means of polymerase chain reaction. Med Microbiol Immunol (Berl) 1990, 179:245ｨC253 Corresponding author: G. Nasioulas, Molecular Biology Research Centre ｰHygeia ｰ ｰAntonis Papayiannis ｱ, 4 Erythrou Stavrou & Kifissias Ave., GR Marousi, Athens, Greece