1, 1, 1, 1, 1, 1,2, 1,2, 1 1 DDBJ 2 AJACS3 2010 6 414:20-15:20 2231
DDBJ DDBJ DDBJ
DDBJ NCBI (GenBank) DDBJ EBI (EMBL-Bank) GEO DDBJ Omics ARchive(DOR) ArrayExpress DTA (DDBJ Trace Archive) DRA (DDBJ Read Archive)
DDBJ Omics Archive DRA Submitter 1 ( ) NCBI EBI DDBJ GEO AE DOR SRA ERA DRA
DDBJ Read Annota8on Pipeline Image data Instrumentation data Sequence + quality (fastq) >Seq1 AGTCGGGTGG.... base calling mass-ftp DRA trace@ddbj.nig.ac.jp http://www.ddbj.nig.ac.jp/sub/trace_sra-j.html MiGAP() RNA-Seq () Plant genome annotations () SNP annotation pipelines NIG Contigs (Overlapping reads) Scaffolds (Supercontigs) Complete genome - Annotation De novo Assembly finishing/gap closure annotation Reference Genome Mapping + Contig + + mass-ftp MSS + Annotation
FASTQ Base Call FASTQ format Q-score (evaluation measure of base calls) @ID Sequence +ID Sequence @ID49_20708_20H04AAXX_R1:7:300:39:401 GTCTCGACCAGCCTCGACAACCTC +ID49_20708_20H04AAXX_R1:7:300:39:401 hhuhhhhhyhhhhhhhehcaa`bskhh\xh Ref. http://en.wikipedia.org/wiki/fastq_format Q score (Phred) ASCII dec 0 64 @ : : 40 104 h ASCII Glyph Solexa (illumina 1.3 format) Q20 Q15
DDBJ PC Cluster Master node 100TB Slave nodes 33 nodes CPU Memory Time Maximum Job# Computer nodes 2*3.16GHz 4GB 168H 42
1
(Quality Score/Coverage ) OUTPUT EVALUATION STATISTICS Pipeline start DRA sequence file FASTQ format quality score coverage mapping tools common alignment file depth SAM/BAM format error rate mapped ratio maximum contig size assembly tools common sequence file FASTA format N50 contig size
DDBJ DOR DDBJ Manual Annotation Pipeline Tag Counting Structural, Functional Annotations Download results via FTP server Genome Mapping de novo Assembly FASTQ + metadata DRA or TRA(temporal) MSS formatted file
trace@ddbj.nig.ac.jp USER 1. data upload 2. pipeline ID trace@ddbj.nig.ac.jp DDBJ Read Archive 5. registration 4. analytical results 3. data analysis DDBJ Read Annotation Pipeline DRA / MSS formatted files DDBJ Mass Submission System 5. registration
DDBJ
DDBJ Read Annotation Pipeline https://p.ddbj.nig.ac.jp/ User ID: guest ( )
FASTQREAD 1. List of data Download and view of DRA metadata 2.Select query files 3. Go to next
1. Select map or assembly 3. Go to next 2. Select a tool
1. Select files for a query set 2. Confirmation 3. Go to next
1. Specify preset, or download/upload 2. Specify an INSD accession number to retrieve data from DDBJ DB 3. Go to next
1. Go to next
1. Run 2. Go to status page
1. Screen login user 2. Goto Download page
A. Download evaluations B. Download output files
Viewer (Tablet) http://bioinf.scri.ac.uk/tablet/ 1. Tablet
Mapping 1. ReferenceMapping.sam
reference 1. Mapping(.sam) 2.Reference
Mapping viewer 1.
Jun Mashima Toshihisa Okido Asami Nozaki Hitoshi Kunii Daisuke Ikumi Takeshi Konno Nobuhiro Hoshi Shouta Morizaki Acknowledgements Yoshio Tateno DDBJ Annotators, members DRA is part of the National project of integrating life science databases, and is supported by the Japan Science and Technology Agency Institute for Bioinformatics Research and Development.