FORTRAN NEC PC8001 (Z-80) N-BASIC NEC PC9801,9821 N88-BASIC, MS-DOS Macintosh, Windows GUI only (Dark period of programming) Linux GNU C, Perl, Tcl/Tk

Size: px

Start display at page:

Download "FORTRAN NEC PC8001 (Z-80) N-BASIC NEC PC9801,9821 N88-BASIC, MS-DOS Macintosh, Windows GUI only (Dark period of programming) Linux GNU C, Perl, Tcl/Tk"

えりかよどぎみ
7 years ago
Views:

1 Infobiologist Infobiologist 0

2 FORTRAN NEC PC8001 (Z-80) N-BASIC NEC PC9801,9821 N88-BASIC, MS-DOS Macintosh, Windows GUI only (Dark period of programming) Linux GNU C, Perl, Tcl/Tk Mac OS X (=Darwin or Free BSD) 1

3 2

4 in vivo 3

5 13Cラベル化合物のࡐ量分析 4

6 5

7 BASIC BASIC (redundant 3. (PC8001, Brother typewriter, interface) 6

8 7

9 EST Excel BLAST, DBGET Clustal W 8

10 9

11 SISEQ 1995 Macintosh, Windows CD Macintosh CodeWarrior Windows Visual C++ CodeWarrior Performa 10

12 Linux 1996 Linux Linux Slackware CD DOS/V 1997 Linux pcmcia PC CD Slackware 11

13 Linux Linux gcc FASTA GenBank GenBank 12

14 SISEQ UNIX Macintosh, Windows SISEQ header GenBank FASTA 13

15 Seqfile typedef struct { long int seqlen; int dtype; /* data type, DNA, RNA, protein */ int circular; char *ID; char AC[30]; /* accession */ char OS[50]; /* organism species */ char dbtype[30]; char *header; char *seq; } Seqfile; /* Structure of description of a sequence. */ 14

16 File format File format /* Sequence file format */ enum filetype { RAW_SEQ, /* 0 */ FASTA_SEQ, /* 1 */ GENBANK_SEQ, /* 2 */ EMBL_SEQ, /* 3 */ SW_SEQ, /* 4 */ EMBL_UK, /* 5 */ PRF_SEQ, /* 6 */ CLUSTAL_SEQ, /* 7 */ PIR_SEQ, /* 8 */ PHYLIP_SEQ}; /* 9 */ 15

17 Exon_record typedef struct { char AC[30]; /* Accession number of sequence segment */ int nc; /* normal (0) or complementary (1) strand */ long begin; /* beginning position */ Boolean begin_ext; /* actual beginning is located upstream, ie, <begin */ long end; /* end position */ Boolean end_ext; /* actual end is located downstream, ie., >end */ } Exon_record; /* Structure of description of exons. */ 16

18 17

19 SISEQ (1) GenBank, EMBL, SwissProt DNA) FASTA *.aln *.aln *.phy 18

20 SISEQ (2) "siseq.cf" Mac, Win GC skew, codon usage, DNA ORF (libseq.a) 19

21 SISEQ (3) SISEQ UNIX TACG 20

22 SISEQ (4) "siseq" Mac, Win "siseq command infile outfile" UNIX "command infile outfile" (GUI) Tcl/Tk "siseq.tk" Graphical Mac, Win 21

23 22

24 SISEQ (5) (Mac siseq setvar form [circular/default]. setvar printline(line) [<number>/default]. setvar addseqg [true,true,1/false]. true: include introns in cdsnuc and extrna. setvar seq_import [true,true,1/false]. true: enables import of external sequences. default, mitochondrion, etc. + external file 23

25 SISEQ (6) "siseq help" ************************************************ Available commands are: 1. txtr 2. getseq2 3. toprot 4. tofast 5. seqcat 21. extcds 22. cdsnuc 23. extrna 24. genlist 25. getent 26. extint 27. noncod 31. getclu 32. chname 33. simtbl 91. codon (explanation) 99. Other commands. ************************************************ 24

26 UNIX LAN OS 25

27 UNIX graphical user interface MacOS X 26

28 UNIX MacOS X G3, G4 UNIX (FreeBSD Darwin) X on Windows Cygwin Windows X Window UNIX gcc Perl UNIX Dual boot Linux Windows Mac Virtual PC OS 27

29 MacOS X MacOS X BLAST UNIX Word, Excel, Illustrator, Photoshop Mac Windows UNIX swap 28

30 MacOS X X Window MacOS X X Window Terminal X Window Linux X Window open source X Window Unix X Window GUI UNIX Clustal X ssh X Window 29

31 MacOS X MacOS X CD Root XDarwin NCBI toolbox

32 MacOS X web page MacOS X web page 31

33 MacOS X C, C++ (cc, c++) (CodeWarrior, RealBASIC) (bash, tcsh) AppleScript (HyperCard Classic Perl, Java, Tcl/Tk, Python, etc. Fortran 32

34 Software resources Software resources Name SISEQ Function Manipulation of large database sequences Source language C Platform UNIX Mac Win GenoMap Graphical representation of microarray data Tcl/Tk UNIX (Mac, Win) LSORT Homology-based clustering of genomeencoded proteins C UNIX UNIX = Linux, MacOS X, IRIX, Solaris 33

35 Discontinuous evolution of plastid genomic machinery N. Sato (2001) Trends in Plant Science 6:

36 Clustering by the homology group method ORF pool Annotation table BLASTP 1st step: BLAST E-value bl2ls2.pl Groups of all possible homologues Homologue list 2nd Alternative step: homology 2nd step: region LSORT3 scanning Subgroups E-value and multidomain Lineage-specific proteins Homology group matrix homology groups homologgroupsg.pl, tbsort6d.pl, etc Homology group sequences 35

37 Example result Example result Group 268: 21 sequences. Syn_sll protoporphyrinogen_ix_oxidase_hemg TE_c47g Predicted_rRNA_or_tRNA_methylase_sll1237_277_1e-74 Ana_alr protoporphyrinogen_oxidase;_hemk NP_c370g SAM-dependent_methyltransferases_sll1237_301_4e-82 Tel_tlr protoporphyrinogen_ix_oxidase S81_g SAM-dependent_methyltransferases_sll1237_183_2e-46 PM1_g SAM-dependent_methyltransferases_sll1237_156_2e-38 PM2_g SAM-dependent_methyltransferases_sll1237_168_9e-42 CA_c1066g SAM-dependent_methyltransferases Ctep_CT HemK_protein Rpal_g SAM-dependent_methyltransferases_hemK_122_3e-28 Rpal_g SAM-dependent_methyltransferases_yfcB_251_7e-67 ATH_At5g putative_protein BS_ywkE similar_to_protoporphyrinogen_oxidase EC_b hemk_possible_protoporphyrinogen_oxidase EC_b yfcb_putative_adenine-specific_methylase SC_YNL063W Hypothetical_ORF Rpal_g SAM-dependent_methyltransferases_TM0691_54_2e-07 BS_yabB similar_to_hypothetical_proteins TE_c3g SAM-dependent_methyltransferases_PM1839_173_2e-43 EC_b yfic_putative_enzyme 36

38 Cyanobacterial genomes An: Anabaena 7120 Np: Nostoc punctiforme Sy: Synechocystis

39 Comparison of cyanobacterial, plant, and other genomes ORFs that might not have been acquired without cyanobacterial endosymbiosis (80) 38

40 Name Syn Ana Species Accession Length Proteins Group Genomes Synechocystis sp. PCC 6803 used AB in 3,573,470 the analysis 3,264 Cyanobacteria Anabaena sp. PCC 7120 BA ,413,773 5,364 Cyanobacteria GC % Jan S81 Synechococcus sp. WH8102 JGI 2,434,431 2,514 Cyanobacteria 59.4 Pm1 Prochlorococcus marinus MED4 JGI 1,657,995 1,694 Cyanobacteria 30.8 Pm2 Prochlorococcus marinus MIT9313 JGI 2,410,873 2,251 Cyanobacteria 50.7 Np Nostoc punctiforme PCC JGI 9.2 Mb 7,281 Cyanobacteria 41.4 TE Tel Ctep Trichodesmium erythraeum Thermosynechococcus elongatus BP-1 Chlorobium tepidum TLS JGI 6.5 Mb 4,841 Cyanobacteria BA000039Total 2,593,857 = 97,563 2,475 proteins Cyanobacteria AE ,154,946 2,252 Green-sulfur CA Chloroflexus aurantiacus JGI 3,854,393 3,372 Green non-sulfur 56.6 Rpal Rhodopseudomonas palustris JGI 5,459,222 4,690 Proteo alpha 65.0 EC Escherichia coli K-12 MG1655 U ,639,221 4,289 Proteo gamma 50.8 BS Bacillus subtilis 168 AL ,214,814 4,100 Low GC Gram SC Saccharomyces cerevisiae NC Mb 6,306 Ascomycota 38.3 SCmt S. cerevisiae mitochondrion AJ , CE Caenorhabditis elegans GenBank Mb 17,083 Nematoda 35.6 CEmt C. elegans mitochondrion X , ATH Arabidopsis thaliana NC Mb 25,545 eudicotyledons 36.0 ATHmt A. thaliana mitochondrion Y , ATHcp A. thaliana chloroplast AP ,

41 Homology groups that are shared by Arabidopsis and photosynthetic prokaryotes. The groups were extracted by varying the threshold E value from 1e-8 to 1e-30, and classified according to the properties of Arabidopsis members. Category Cpencoded Nuc-encoded With transit seq. No transit seq. Annotation given No annotation Annotation given No annotation Total 8 Cy & Ath (19) Cy & Ath & 1-3 Ph Potential novel 8 25 ( 7) photosynthesisrelated genes Total (26) Cy, cyanobacteria; Ath, Arabidopsis; Ph, photosynthetic bacteria. Cp, chloroplast; Nuc, nucleus; Transit seq., transit sequence. 40

42 Contribution of cyanobacterial genome to plant (chloroplast and nuclear ) genomes Endosymbiotic origin of chloroplast The ancestor of chloroplasts must be a common ancestor of all the cyanobacteria analyzed. 41

43 GenoMap showing the gene expression in whole genome 42

44 Thanks to: Saitama S. Ehira T. Hamano Tokyo M. Ohmori M. Ikeuchi Kazusa S. Tabata T. Kaneko Kyushu S. Kuhara K. Tashiro 43

プレゼンテーション2.ppt

プレゼンテーション2.ppt ryamasi@hgc.jp BLAST Genome browser InterProScan PSORT DBTSS Seqlogo JASPAR Melina II Panther Babelomics +@ >cdna_test CCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCAC ACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTG