A, B 2 B 5 A C A ADP A G ADP ADP G camp B GM A B CTB Tochikubo et al., 1998 CTB CTB Dertzbaugh & Elson, 1993a; Yu et al., 1994; Shi et al., 1995 CTB C

Size: px

Start display at page:

Download "A, B 2 B 5 A C A ADP A G ADP ADP G camp B GM A B CTB Tochikubo et al., 1998 CTB CTB Dertzbaugh & Elson, 1993a; Yu et al., 1994; Shi et al., 1995 CTB C"

たみじろうだいほうじ
5 years ago
Views:

1 2004 Analysis of the expression of cholera toxin B-subunit gene

2 A, B 2 B 5 A C A ADP A G ADP ADP G camp B GM A B CTB Tochikubo et al., 1998 CTB CTB Dertzbaugh & Elson, 1993a; Yu et al., 1994; Shi et al., 1995 CTB CTB CTB pqe30 pet28a CTB SDS-PAGE CTB GM1 ELISA CTB: cholera toxin B subunit B CT: cholera toxin CBB: coomassie brilliant blue SDS-PAGE: SDS IPTG: isopropyl- -D-thiogalactoside ELISA: enzyme-linked immunosorbent assay 2

3 CTB Vibrio cholerae 569B CTB CTB BamH Hind 2 PCR CTB 5 BamH 3 Hind CTB BamH 5 actgcggatccatgattaaattaaaatttg 3 Hind 5 tggagcaagcttttaatttgccatactaatt 3 PCR CTB TA pdrive E. coli JM109 SDS pdrive BamH Hind CTB (1) pqe30 CTB pqe30 Qiagen, ampicillin MCS BamH Hind BamH pqe30 CTB DNA ( DNA Ligation Kit) E. coli JM109 SDS BamH Hind CTB DNA E. coli M15[pREP4] CTB pqe30 CTB pqe30 RNA polymerase pqe T5 prep4 kanamycin lac Iq 2 lac lac O isopropyl- -D-thiogalactoside (IPTG) pqe30 2 lac T5 (Fig. 1) 3

4 (2) pet28a CTB CTB PCR CTB BamH 5 actgcggatccacacctcaaaatattactg 3 CTB pqe30 pet28a kanamycin BamH Hind pet28a E. coli BL21(DE3) pet28a BL21 BL21(DE3) T7 RNA polymerase pet T7 pet28a BL21(DE3) lac I lac lac T7 RNA polymerase pet lac T7 IPTG lac T7 RNA polymerase pet lac T7 (Fig. 2) 4

5 pqe30 BL21(DE3) pqe30 T5 RNA polymerase M15 BL21 prep4 lac Iq pet28a M15[pREP4] DNA T7 RNA polymerase pet 5

6 (3) 37 pqe30 LB ampicillin (100 g/ml) kanamycin (25 g/ml) OD IPTG mm 16h pet28a kanamycin (25 g/ml) IPTG 1mM 16h (1) CTB 8M 8M -100mM -10mM Tris-HCl, ph8.0 His Ni ph CTB QIAGEN The QIA expressionist: A handbook for high-level expression and purification of 6 x His-tagged protein CTB 8M -100mM -10mM Tris-HCl, ph6.3 8M, 4M, 2M, 1M, 0M 2 Dialysis Membrene, Size 20 (Wako) BCA BCA Protein Assay Reagent Kit (PIERCE) (2) SDS-PAGE 15 SDS-PAGE CBB CT CTB SDS-PAGE PVDF PVDF Transfer Membrane Pack No RPN2020F, Amersham Life Science 1 Cholera toxin antibody (Sigma, C3062) 2 Anti-rabbit Ig Horseradish Peroxidase linked whole Antibody (from donkey) (Amersham Biosciences, Lot ) ECL Western Blotting Analysis System (Amersham Bioscience, RPN2109) NIH Image ( (3) ELISA CTB GM1 ELISA ELISA 1 2 6

7 ELISA Spangler Spangler, GM1 GM1 (20 g GM1/ml ) 1/ ng CTB Cholera toxin B subunit from Vibrio cholerae, Sigma, C ng/ml 6.25ng/ml 12.5ng/ml 25ng/ml 40ng/ml 50ng/ml 50 l 2, 2 -azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (Liquid Substrate System for ELISA, Sigma A3219) 3 450nm pqe30 CTB pqe30 2ml CTB CTB pqe30 CTB Fig. 3 CTB CTB (Met) Ile Val pet28a CTB PCR hydropathy index Ile 4.5 Val 4.2 CTB 7

8 (A)pET28a CTB pet28a CTB (B) CTB 6 His pet28a pqe30 CTB (LTB) pet (Spangler, 2002) pet28a BL21(DE3) SDS-PAGE CBB CTB Fig. 4 L 13mg Areas et al., 2002 CTB 50ml CTB NIH image CTB Table 1 CTB 9.88 g 10 TCA 7.74 g g CTB 8

(A) (B) (A) SDS-PAGE CBB (B) SDS-PAGE CT 5 (ml) (A) SDS-PAGE WB CTB CTB ( g) (ml) CTB ( g) ( g/ml) (C)/(B) (C)/(B) (A) (B) (C) 0.43 0.005 0.09 18 7.74 39.5 0.627 0.006 0.

9 (A) (B) (A) SDS-PAGE CBB (B) SDS-PAGE CT 5 (ml) (A) SDS-PAGE WB CTB CTB ( g) (ml) CTB ( g) ( g/ml) (C)/(B) (C)/(B) (A) (B) (C) (TCA ) CTB 0.43ml 5 l SDS-PAGE 39.5ml ml 10 l SDS-PAGE 400 l TCA TCA10 20mM Tris-HCl 50 l 10 l SDS-PAGE CTB CT WB NIH Image CTB 9

10 CTB CT CT CTB (Cao et al., 1995; Shi et al., 1995) CTB 2ml SDS-PAGE CTB CBB CTB (Fig. 5) CTB (A) (B) (A) No.1 No.7 SDS-PAGE CBB (1) (2) CTB (3)IPTG No.1 (4) (10) IPTG No.1 No.7 (B) CT 30 50ml CTB His Ni ph SDS-PAGE CBB Fig. 6 CTB CTB CTB CTB BCA Table 2 IPTG Tris-HCl, ph8.0 10

11 (1.63mg) 2.5% (1.63mg) L 32.6mg Areas (2002) 13mg/L CTB 1/100 SDS-PAGE CBB (1) (2) CTB (3)IPTG (4)IPTG 24 B buffer 8M -100mM -10mM Tris-HCl, ph8.0 (5)Ni (6)C buffer 8M -100mM -10mM Tris-HCl, ph6.3 (7)D buffer 8M -100mM -10mM Tris-HCl, ph5.9 (8)E buffer 8M -100mM -10mM Tris-HCl, ph4.5 11

12 [ml] [mg/ml] [mg] [%] B buffer Flow through C buffer D buffer E buffer IPTG 24 B buffer (8M -100mM -10mM Tris-HCl, ph8.0) B buffer His Ni Flow through C buffer (8M -100mM -10mM Tris-HCl, ph 6.3) D buffer (8M -100mM -10mM Tris-HCl, ph5.9) CTB E buffer (8M -100mM -10mM Tris-HCl, ph4.5) Ni CTB 14kDa, 24kDa 45kDa SDS-PAGE Fig. 6 CTB 11kDa CTB 15kDa 14kDa CTB CTB CTB pet28a His 34 N CTB SDS-PAGE 14kDa 26kDa, 42kDa, 56kDa, 68kDa Fig. 7 A, B, C, D, E Fig. 8 CTB1 14.2kDa A CTB1 B, C, D, E CTB CTB CT CTB Fig

A 2 3 4 5 5 L SDS-PAGE (1) (2) CTB (3)IPTG 24 B buffer 8M -100mM -10mM Tris-HCl, ph8.

13 A L SDS-PAGE (1) (2) CTB (3)IPTG 24 B buffer 8M -100mM -10mM Tris-HCl, ph8.0 (4)Ni (5)C buffer 8M -100mM -10mM Tris-HCl, ph6.3 (6)D buffer 8M -100mM -10mM Tris-HCl, ph5.9 (7)E buffer 8M -100mM -10mM Tris-HCl, ph4.5 13

14 (A) (B) (C) (D) (E) Fig. 6 A, B, C, D, E CTB Ni 14

15 CT CTB GM1 GM1 CTB CTB GM1 ELISA CTB 15 Fig. 10 (B) CTB 100 Fig. 10(A) GM1 CTB 0.933ng/well Table 3 BCA ELISA (160ng/well) 0.6 CTB GM1 BCA 160ng/well (100%) ELISA 0.933ng/well (0.6%) CTB(0.32mg/ml) 100 GM l BCA 160ng CT 2 Fig GM1 CTB 15

16 (A) (B) (A) CTB GM1 CTB(0.32mg/ml) l 100 GM1 CTB (B) CTB CTB 15 16

17 pqe30 pet28a CTB pqe30 CTB pet28a CTB CTB CTB CTB CTB CTB (Cao et al., 1995; Shi et al., 1995) CTB Table 1 CTB pqe30 CTB CTB CTB CTB CTB GM1 ELISA CTB GM1 CTB 0.6 GM1 CTB CTB GM1 CTB 5 SDS-PAGE 5 pet28a 3.4kDa CTB N GM1 CTB N (25kDa) CTB GM1 (Liljequist et al., 1997; Dertzbaugh & Elson, 1993b) CTB SDS-PAGE CTB SDS 5 1 CTB CTB CTB CT SDS-PAGE CTB 17

18 CTB C CTB 32.6mg/l GM1 CTB 0.6 GM1 CTB CTB Areas AP, Oliveira ML, Ramos CR, Sbrogio-Almeida ME, Raw I, Ho PL. Synthesis of cholera toxin B subunit gene: cloning and expression of a functional 6 His-tagged protein in Escherichia coli. Protein Expression Purification ;25(3): Cao C, Shi C, Li P, Ma Q. A secretion expression system using promoter and signal peptide of cholera toxin B subunit gene. Chin J Biotecnol. 1995;11(2): Dertzbaugh MT, Elson CO. Comparative effectiveness of the cholera toxin B subunit and alkaline phosphatase as carriers for oral vaccines. Infect Immun. 1993a;61(1): Dertzbaugh MT, Elson CO. Reduction in oral immunogenecity of cholera toxin B subunit by N-terminal peptide addition. Infect Immun. 1993b ;61(2): Liljeqvist S, Stahl S, Andreoni C, Binz H, Uhlen M, Murby M. Fusions to the cholera toxin B subunit: influence on pentamerization and GM1 binding. J Immunol 18

19 Methods ;210(2): Shi CH, Cal C, Xhig JS, Li J, Ma QJ. Gene fusion of cholera toxin B subunit and HBV PreS2 epitope and the antigenicity of fusion protein. Vaccine ;13(10): Spangler, BD. Methods in Molecular Biology and Protein Chemistry: Cloning and Characterization of an Enterotoxin Subunit. pp , 2002, Wiley. Tochikubo K, Isaka M, Yasuda Y, Kozuka S, Matano K, Miura Y, Tanibuchi T. Recombinant cholera toxin B subunit acts as an adjuvant for the mucosal and systemic responses of mice to mucosally co-administered bovine serum albmin. Vaccine. 1998; 16(2-3): Yu X, Ma Q. Construction of an engineered bivalent vaccine strain consisting of Vibrio cholerae CT-B and LPS-O antigens. Chin J Biotechnol. 1994; 10(4):

Microsoft Word - H18年度生命工学報告書　Astro　ver.3

Microsoft Word - H18年度生命工学報告書　Astro　ver.3 1. Rotavirus Norovirus Adenovirus Astrovirus Sapovirus 5 1) Human Astrovirus HastV 1975 Madeley Cosgrove EM RNA 30nm 5 6 Fig. 1 2) HastV 8 3 5 HastV ELISA Enzyme-Linked ImmunoSorbent Assay RIA Radio immunoassay